Life Science Tools of the Trade

Being a sensitive sort, easily offended by some of the rougher language used in the lab when experiments don’t work, I instituted a “curse jar” about a year ago.

The Rules: A slip of the lip and it costs you 25 cents. The litmus test is if you can’t (shouldn’t) say it in front of my kids you pay. Four obscenities for a dollar-no bulk discounts. The first year we paid for lunch and beers at El Corral (a favorite Mexican restaurant). After a fast and expensive start the lab language has cleaned up considerably and at the present snail’s pace we’ll be lucky to collect enough coins to buy  a bottle of cheap red wine and a box of Little Debbie Swiss Cake Rolls by the end of the year.

PS: Lyrics don’t count as long as you don’t sing along.

In general, I don’t believe there is anything magical about doing PCR.  I don’t use primer designing software or figure out the Tms of my oligos.  My theory is this:  the oligos need to sit down where you need them to sit - irregardless of the sequence.   So, I order the oligos and just assume the PCR will work.

That being said, I’ve never had to do PCR on such a GC rich template in my life!!  Short of the A of the ATG the first 26 bases of this gene are either a G or a C.  To add to the complication, I don’t have a cDNA template, I’m trying to PCR the gene from a library.

Needless to say, I haven’t been having much luck.  Today I had to break down and start pulling out those PCR optimization kits.  You know the ones.  Generally, they have a panel of buffers with different pHs or different MgCl2 concentrations. 

The kit I used today isn’t like that though.  It’s specifically for GC rich templates and comes with a tube of “GC melt”.   You set up 4 reactions with different amounts of this magical elixir and voila… a nice clean band on your gel.

When I left the lab today the PCR was still running so I have yet to know if it worked.  I guess my mood-o-meter will be determined first thing in the morning when I run that gel out.  There will either be shrieks of joy or cursing and mumbling of failure.  Either way, I’ll let you know how the kit worked.

I attended a recent Roche bagel breakfast to congratulate Susan on her deserved promotion. There were little rubber bracelets, that often read WWJD, LiveStrong or some other semi-inspiration/fund raising phrase, as free promo items. These had a DNA sequence 24 letters long! What did it encode? Was there a prize to be had? What a mystery to be uncovered! Certainly, the marketing people wouldn’t just type in some mumbo jumbo sequence. There must be a clue, a message, a reason!

gacttgcctatcgatccgtaccgt

A BLAST search revealed:

: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS,
GSS,environmental samples or phase 0, 1 or 2 HTGS sequences)
3,735,524 sequences; 16,505,994,612 total letters

Query=
Length=24

No significant similarity found.

I’m surfing the internet looking for some information about a vector I might use. I found a site, I’m not going to even mention their name because I don’t want some sales rep calling me about it, and they would not allow me to look at the site. The bottom line is I had to set up an account to get the information! I simply wanted some info on the available cloning sites and I wasn’t about to set up an account for that.
If the vendor doesn’t make it easy I’ll just find another vendor or better yet find someone down the hall with a vector with the cloning sites I need and save myself $295!

News from the Vendor Show:

A big PFTTTTTTTTTTT! for this innovation. Add some orange color and sell your polymerase as Mango Taq! It leaves an A overhang! Note to BioLine’s QC team: it leaves an A overhang because it doesn’t have proofreading ability so pehaps you should market is as a new and improved ” low-fidelity Taq for all your mutagenic needs!”
Verdict: I’ll stick with Taq Plus Precision from Stratagene.
Rumor mill: a favorite sales rep changes jobs……..goodbye and thanks! See you at the bar!

My current project is to try to map the NLS and the import factor of my favorite protein. The problem is: everything I have tried has failed and I’m no closer to my goal than I was at the beginning of December. With the holidays, I decided to set up a yeast 2-hybrid library screen and let it cook while I was out of town.

Well….when I got back to work, colonies had grown on the plates and the work was just beginning. I grew the colonies up, assayed them, and then rescued the library DNA. I then grew up these colonies and purified the DNA. After sending the DNA down to be sequenced and re-transforming it to verify the interaction….what do I have? Six proteins that specifically interact with my bait protein but none of which are import factors!

So here’s my question: where the heck do I go next? I’ve done blast searches and pulled up countless papers on these proteins. How do I know what’s relevant and what should get thrown in the garbage. I, of course, don’t want to admit defeat so I’m exploring a few of the possibilities.

The thing that’s really frustrating about all of this is that technically the library screen worked perfectly. I just didn’t get what I wanted.

What I have learned is this: LUCK plays a major role in science and I don’t have any.

“As Gregor Samsa awoke one morning…….” or “I first met Dean not long after……..” or “Call me Ishmael.”
Quick, can you recite the first line from any scientific manuscript? I doubt it. I can’t.

With that in mind, may I present to you for your enjoyment:
http://nar.oxfordjournals.org/cgi/content/full/34/1/89

SAB Mood O’ Meter- excellent as we enter the third day of Gavrignoring.
Music- “Fare Well ” Uma (Chris Hickey on most vocals).
Book-LOTR’s “Two Towers” (confession time, not reading but listening on CD).
Lab irritation-a plasmid received on whatman paper that will not transform
SAB irritation (minor)-discussions AND advice about molar ratios, vectors and inserts.

Why didn’t I sign up at SAB using an alias so I could be (even more) brutely honest. Instead I sign up wth my real name. Henry Bert Ogerd aka hbogerd. A quick PubMed search leads them to me (hbogerd) which then, obviously, links you to noted co-author and conspirator Helen Wanda Iegand aka hwiegand. Unfortunately, I was too naive and it didn’t take a Dick Novak or Karl Rove to expose me.

Thanks to the Biorewards program at GE healthcare (formerly Amersham) for the t-shirts and coolers.

The dilemma was determining who would get which item. Hmmm… leave it to hbogerd to come up with a unique solution. Personalized lottery balls with each lab members name for lucky lotto.

Doehle got first choice - he took the cooler as a nice birthday gift for his wife. And so the game went on until everyone got something.

Jen and Alex are running around with their coolers like giddy school girls and everyone else has their t-shirts on.

What a way to spend the afternoon.

Okay, the full refund/warranty offered by Qiagen in reality seems to be about 75 cents on the dollar. I guess it is a reasonable offer but I have to say the conflicting, “Yep, we sent defective product” and “No, we didn’t” disturbing to say the least. Qiagen has basically known about the “Qiafuzz” I discussed in another forum for over 10 years. Yes, they knew and proposed the idea of super carbohydrate bacteria that produced insoluble material that magically bound the column and eluted with the DNA. It always sounded ridiculous to me, and I wondered why they didn’t market it as a “CarbEasy Kit”.
Ah, enough of that. The Qiagen PCR purification kits are fine, the mini-prep kits yield DNA which sequences nicely. Having said that, when Qiagen changes sales reps (in spite of these recent problems, Rebecca the current rep is very nice and actually cares about us as customers) I suspect we will be looking at other vendors.

I received a phone message from the Senior Tech person at Qiagen over the break. I wasn’t in the mood to conintue my Qia-rant on my vacation or even think about science, so I didn’t return his call. Today, he called again and we had a brief, reasonably pleasant, conversation.
Update: I had been told point-blank by the Qiagen Sales people that, yes, in fact Qiagen had sent out defective product that did not pass Quality Control. Ooops, sorry about that! However, on the phone no such confession was made. So, the real question is “Who do I believe?” I have no idea.
Remember Qiagen offers a “PRODUCT WARRANTY AND SATISFACTION GUARANTEE”. The refund process is underway. I’ll keep you posted.
Newsflash: The insoluble Qiafuzz has been identified! It is column matrix that somehow elutes/leaks through the frit. At least we don’t have to listen to the “E. coli carbohydrate theory” anymore.