No significant similarity found.
Saturday, January 28th, 2006I attended a recent Roche bagel breakfast to congratulate Susan on her deserved promotion. There were little rubber bracelets, that often read WWJD, LiveStrong or some other semi-inspiration/fund raising phrase, as free promo items. These had a DNA sequence 24 letters long! What did it encode? Was there a prize to be had? What a mystery to be uncovered! Certainly, the marketing people wouldn’t just type in some mumbo jumbo sequence. There must be a clue, a message, a reason!
gacttgcctatcgatccgtaccgt
A BLAST search revealed:
: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS,
GSS,environmental samples or phase 0, 1 or 2 HTGS sequences)
3,735,524 sequences; 16,505,994,612 total letters
Query=
Length=24
No significant similarity found.
